Для чего праймер: для чего нужны и рейтинг лучших с отзывами

Содержание

для чего нужны и рейтинг лучших с отзывами

Если ваш макияж держится не так долго, как хотелось бы, не спешите покупать новый тональный крем. Возможно, вам просто стоит добавить в косметичку праймер

Праймер – это косметическое средство, которое наносится под тональную основу. Его основные функции – это фиксация макияжа, защита кожи от внешнего воздействия и выравнивание тона кожи. Праймер для лица до недавнего времени редко встречался вне косметичек профессиональных визажистов. Но сегодня его оценили по достоинству и «обычные» бьютиголики. Все, что вам нужно знать об этом средстве, мы собрали в одном материале.

© Makeup.ru

Для чего нужен праймер для лица?

Праймер для лица играет далеко не последнюю роль в создании безупречного мейкапа и берет на себя целый набор важных функций.

© Makeup.ru

  • Праймер – это база под тональное средство. Содержащиеся в его составе компоненты помогают значительно продлить стойкость макияжа.
  • Средство выравнивает рельеф кожи, делая ее более гладкой, а также зачастую помогает скрыть мелкие недостатки – например, расширенные поры. Благодаря этому тональная основа распределяется более ровным слоем.

© Makeup.ru

  • Многие праймеры хорошо выравнивают тон. Разумеется, им не под силу заменить «полноценное» тональное средство, но с легкими покраснениями они вполне успешно справятся.
  • В составе некоторых праймеров есть компоненты, которые приносят пользу коже: ухаживают за ней, увлажняют и защищают от негативного воздействия солнца.

© Makeup.ru

Понимая, зачем нужен праймер для лица и какие функции он выполняет, просто решить, насколько необходимо его использование конкретно для вас. Он будет особенно полезен, если ваш макияж обычно не отличается стойкостью, если ваша кожа жирная или склонна к покраснениям.

Вернуться к оглавлению

Виды праймеров для лица

Существует несколько типов праймеров, выбирать «свой» стоит в зависимости от цели использования и состояния кожи. Разбираемся в вопросе.

Текстуры праймеров

Силиконовый праймер для лица

© Getty images

Если вы хоть раз задавались вопросом, для чего нужен бесцветный праймер для лица, то речь шла о праймере на силиконовой основе. Силиконовые праймеры для лица решают одну из самых важных задач – выравнивают рельефа кожи. Такой праймер создаст ровную базу для нанесения макияжа: сузит расширенные поры и сгладит другие неровности. Как правило, силиконовые праймеры имеют гелевую текстуру, благодаря которой практически не ощущаются на коже. Идеально подходят для жирной и возрастной кожи, но противопоказаны проблемной.

Кремовый праймер для лица

© Getty images

Кремовые праймеры универсальны и подходят практически любому типу кожи. Их основное свойство – качественное увлажнение – способствует более комфортному и простому нанесению тона. Как бонус – свежая и красивая кожа.

Жидкий праймер для лица (лосьон)

© Getty images

Средство с легкой текстурой на водной основе – праймер-лосьон. Одно из основных его достоинств – невесомость. Вы не будете ощущать праймер на коже, однако он будет выполнять ряд важных функций. Среди них – экспресс-увлажнение (отличный вариант, если приходится делать макияж «на бегу») и выравнивание тона. При условии, что в состав средства не входят масла, праймер с такой текстурой подойдет обладательницам жирной и комбинированной кожи.

Масло-праймер для лица

© Getty images

Масло-праймер для лица обладает сразу несколькими положительными свойствами. Масла преображают кожу: она становится более упругой, сияющей, а мелкие морщинки разглаживаются. Также масла способствуют более комфортному нанесению тональной основы. Масло-праймер – оптимальное и многофункциональное средство, сочетающее свойства декоративной и уходовой косметики.

Цель использования

Матирующий праймер для лица

Жирный блеск на коже способен испортить даже самый идеальный макияж. Чтобы таких ситуаций не возникало, и придумали матирующий праймер. Основная функция этого средства – абсорбировать сальные выделения кожи, при этом не загрязняя поры. Чаще всего матирующие праймеры содержат в составе минеральные частицы.

Сияющий праймер для лица

Светоотражающие частицы в составе такого праймера «подсвечивают» кожу. Праймеры для лица с эффектом сияния помогают выглядеть более свежей и отдохнувшей, преображая оттенок кожи лица. Выбор такого праймера зависит от тона кожи: средство выпускается в разных оттенках.

Зеленый праймер для лица (корректирующий)

Такой праймер наносится на отдельные участки кожи. Корректирующий праймер способен убрать покраснения, небольшие высыпания и другие недостатки. Зеленый пигмент отлично справляется, когда нужно скрыть неровность тона кожи. По цели использования и консистенции он скорее напоминает не базу, а корректор или консилер.

Вернуться к оглавлению

Как выбрать праймер для лица?

© Makeup.ru

Лучшие праймеры для лица, по мнению визажистов, – это те, что подходят вашему типу кожи. В противном случае праймер не только не будет выполнять своих базовых функций, но может и создать ряд других проблем. Также выбор этого средства зависит от состояния вашей кожи в данный момент: правильно подобранное средство поможет его улучшить.

Праймер для жирной кожи

  • Главная цель праймера для лица для жирной кожи – сделать поры менее заметными, при этом «затормозив» выделение кожного сала. Минеральные праймеры отлично с этим справляются: минеральные частицы в составе матируют кожу и избавляют ее от жирного блеска.
  • Минералы выполняют еще одну функцию – «успокаивают» кожу, помогают нейтрализовать покраснения и раздражения.
  • Для жирной кожи также подойдет и силиконовый праймер – но только если кожа находится в хорошем состоянии и не имеет видимых недостатков.
  • При выборе «своего» средства очень важно обращать внимание на состав: в нем не должно содержаться минеральных масел.

Советуем почитать:

Праймер для сухой кожи

Сухая кожа, как правило, особенно чувствительна к косметическим средствам. Обращайте внимание на праймеры с кремовой или жидкой основой. Основная задача средства в этом случае – увлажнить кожу перед макияжем, чтобы обеспечить более ровное нанесение тональной основы. В составе некоторых средств содержится гликолевая или салициловая кислота – компоненты, которые способствуют увлажнению и очищению.

© natalievenas

Советуем почитать:

Праймер для комбинированной кожи

Обычно для комбинированной кожи подходят те же самые средства, что и для жирной – различие лишь в том, что база наносится на определенные участки кожи. Отлично подойдут минеральные праймеры, которые избавят Т-зону от излишка себума, покраснений и мелких недостатков. Если кожа находится в хорошем состоянии, праймер на силиконовой основе можно наносить на всю кожу лица.

Праймер для возрастной кожи лица

Основная цель праймера для возрастной кожи – заполнить морщинки, которые неизбежно появляются на лице с возрастом. Для этой цели будут эффективны силиконовые праймеры – и все благодаря их свойству выравнивать рельеф кожи. В составе средства обязательно должны быть увлажняющие компоненты (так как возрастная кожа часто склонна к сухости). Также принесут пользу антиоксиданты. А вот сияющих частиц в составе лучше избегать.

Вернуться к оглавлению

Как пользоваться праймером для лица?

Наверняка вы подумали: «Что в этом сложного?» – и оказались правы. Действительно, нанесение праймера – простейшая процедура, при выполнении которой, однако, стоит учесть некоторые детали. Рассказываем, как наносить праймер на лицо в домашних условиях. Следуйте пошаговой фотоинструкции.

1

Очистите и увлажните кожу перед нанесением. Действительно, многие праймеры уже содержат увлажняющие компоненты, но они не могут заменить полноценного увлажнения. Поэтому не забывайте провести ваши привычные бьюти-ритуалы перед нанесением.

© Makeup.ru

2

Способ нанесения зависит от текстуры средства: например, силиконовый праймер-гель можно наносить локально на некоторые участки кожи, а праймер-лосьон распределять по всей коже лица.

© Makeup.ru

3

Проще всего наносить праймер пальцами: двигайтесь от середины лица к краям мягкими движениями, равномерно распределяя средство.

© Makeup.ru

Помните, что не каждый праймер подходит для проблемных участков кожи. Какой праймер для лица лучше выбрать в этом случае? Стоит обратить внимание на универсальные средства или пользоваться несколькими в зависимости от текущего состояния вашей кожи.

Более подробно о том, как наносить праймер, вы можете узнать из этой статьи и из нашего видеоурока.

Вернуться к оглавлению

Чем можно заменить праймер для лица?

Альтернатив этому средству найдется мало – но они все же есть. Что можно использовать вместо праймера для лица?

© Makeup.ru

BB-крем позиционируется как универсальное средство, которое также может служить и базой под макияж. У него есть множество плюсов: оно и увлажняет, и питает, и выравнивает тон. Но если вы собираетесь нанести поверх еще и тональную основу, используйте ВВ-крем в небольшом количестве (подробнее о ВВ-креме мы писали здесь).

© Makeup.ru

2

Бальзам после бритья

Как ни странно, он может в sos-ситуации заменить праймер. Он матирует кожу, выравнивает ее – и макияж держится гораздо дольше. Но к этому лайфхаку стоит прибегать только в крайнем случае, для ежедневного использования в качестве праймера бальзам после бритья, конечно, не подходит.

3

Увлажняющий крем

Его, как мы уже писали, нужно наносить в любом случае – но в ситуации, когда праймера под рукой нет, он становится настоящим спасением. Увлажняющий крем подготовит кожу к нанесению тональной основы, сделает ее более мягкой и ровной.

© Makeup.ru

Эти средства – подходящая замена, когда праймера нет под рукой, однако использовать их в качестве базы на постоянной основе не рекомендуется.

Вернуться к оглавлению

Рейтинг лучших праймеров для лица (по мнению редакции)

Мы подготовили топ-6 праймеров, которые по нашему мнению действительно справляются со своей работой.

© Makeup.ru

  • Baby Skin, Maybelline

    © maybelline.com.ru

    Если вы никогда не пользовались праймером и не знаете, с чего начать, рекомендуем это средство. Baby Skin скрывает неровности кожи и расширенные поры. Этот праймер очень удобен в нанесении: благодаря невесомой гелевой текстуре он практически не ощущается на коже.

    Отзывы

    • Екатерина Самойлова (y**[email protected])

    Baby Skin Maybelline — одна из лучший основ под макияж, которую я пробовала. Поры не забивает, прыщей не вызывает, кожа бархатная и все косметические средства ложатся идеально!

    • Kristine Ovsepian (kr****[email protected])

    Основа под макияж Baby Skin, Maybelline является самым эффективным и лучшим праймером из масс маркета. Он действительно скрывает поры, делает лицо матовым (для жирной кожи это особенно важно ), увлажняет кожу и очень экономично расходуется. Праймер хорошо скрывает все недостатки и самое важное, что не скатывается. Мой идеальный праймер.

    • Кристина (cris.ku****[email protected])

    Здравствуйте ,хотела бы оставить отзыв на мой любимый праймер от MAYBELLINE baby skin. У меня кожа достаточно проблемная , а именно жирная и с постоянно расширенными порами . В такой ситуации меня выручает праймер baby skin.Он прекрасно скрывает мои вечные проблемы с порами , обладает матирующим эффектом, делает кожу бархатистой ,значительно продлевает стойкость макияжа . Праймер можно использовать как самостоятельное средство или как основу под макияж . Само средство не имеет цвета , легко наносится и МОМЕНТАЛЬНО маскирует мои недостатки ! когда я пользуюсь им ,то получаю много комплиментов от моих подруг , они постоянно спрашивают как я ухаживаю за своей кожей ,кремами пользуюсь ,но весь секрет в праймере 😉 Это чудо занимает почетное место в моей косметичке!!

  • Infaillible Mattifying Primer, L’Oréal Paris

    © loreal-paris.ru

    Благодаря матирующему эффекту средство пользуется популярностью среди девушек с жирной и комбинированной кожей. Главные его плюсы – легкая кремовая текстура и высокая стойкость. Infaillible Mattifying Primer способен надолго избавить кожу от жирного блеска, а также «продержать» тональную основу целый день.

    Отзывы

    Алина (ali****[email protected])

    Праймер Infaillible от L’Oréal Paris супер. Скрывает все неровности, сглаживает. Пользуюсь только им

  • Touche Éclat Blur Primer, YSL

    © yslbeauty.com.ru

    Праймер, который придает коже сияние и создает ровный тон. В его состав входят масла, смягчающие и питающие кожу. Состояние кожи явно меняется в лучшую сторону: расширенные поры сужаются, исчезают неровности, выравнивается тон. Такой праймер подходит для любого типа кожи.

    • Наталья (Apr***[email protected])

    «Стоп! Поиски окончены. Я нашла его!», — сказала я себе, впервые попробовав свой идеальный праймер от YSL. Ровный цвет лица и идеальный рельеф кожи – все это подвластно Touce Éclat Blur Primer Base De Teit Fluide. Как? При помощи миллионов искрящихся частиц, которые подобно весеннему утреннему солнцу окутывают кожу и полностью скрывают мелкие дефекты и расширенные поры. База имеет такой же формат, как и мой любимый Le Teint Touche Eclat. Великолепная и утонченная бутылочка, увенчанная золотой крышкой с логотипом YSL. Праймер имеет очень-очень легкую и приятную гелевую текстуру. Четыре восхитительных гидратирующих масла в составе отлично питают кожу, насыщая ее влагой, при этом не утяжеляют и не оставляют жирной пленки. Результат: кожа становится гладкой, появляется внутреннее сияние, поры сужаются. Мне очень нравится эффект, который дает праймер в сочетании с Touche Eclat Le Teint. А еще основа отлично показала себя на коже вокруг глаз!

    • Елена (tr*****[email protected])

    Несомненно и бесспорно! Touche ECLAT Blur -лучший праймер и один из моих любимейших продуктов от YSL. Используя его, приходишь в восторг от Вау-эффекта. Магически-шикарная текстура. Кожа мгновенно становится бархатной, отлично выравнивает тон и, что очень важно для меня, на него хорошо ложатся тональные средства. А еще он как бы разглаживает поры,делает их менее заметными, но при этом совсем не забивает их. Полный комфорт и увлажнение в течении всего дня.+Очень экономичный расход. Этот праймер я рекомендую всем!

  • Born to glow Illuminating Primer, NYX Professional Makeup

    © nyxcosmetic.ru

    Этот праймер от NYX Professional Makeup с гелевой текстурой придаст коже сияющий оттенок. И бережно подготовит ее к макияжу: средство выравнивает тон, смягчает кожу и дарит сияние. Праймером Born to Glow можно пользоваться обладательницам любого типа кожи: средство универсально и не доставляет дискомфорта в течение дня.

    Отзывы

    • Anna (a***[email protected])

    Маст-хэвом из многочисленного ассортимента косметических средств компании Nyx для меня всегда являет жидкий хайлайтер Liquid Illuminator. Оттенок 01 «Sunbeam» отлично подходит для девушек со светлой кожи лица,и даже для очень бледной. Хайлайтер Nyx является универсальным средством:лично я испульзую его не только на те зоны,которые хочу высветлить,но и на глаза,поверх теней,чтобы придать сияние и легкое свечение.А так же наношу на ключицы и шею,если делаю вечерний макияж.Но не переусердствуйте:) В линейке» Born to glow» есть оттенки потемнее для мулаток и чуть темнее для девушек с темной кожи лица. Очень богатое свечение,его я использую как и на полноценный макияж так и на легкий повседневный. Даже не нужно наносить тон,достаточно лишь праймера и этого «волшебника» и вы будете настоящим лучиком солнца!❤️ #nyxcosmeticsrussia

  • Stage Performer block: booster, Shu Uemura

    © shuuemura.ru

    Линия средств Stage Performer была разработана профессиональными визажистами, которые часто работают на бэкстейджах показов и точно знают, какой должна быть основа под макияж. Одно из средств этой линии, праймер block: booster, стоит выделить особенно. Он не только готовит кожу к нанесению мейкапа и продлевает его «жизнь», но еще и защищает кожу от вредного воздействия окружающей среды (например, УФ-лучей). Увлажняющие компоненты в составе праймера помогут коже оставаться мягкой на протяжении целого дня. Также благодаря салицилатам в составе средство обладает противовоспалительным эффектом.

  • Urban Defence Complexion Primer, Urban Decay

    © urbandecay.ru

    Новинка от Urban Decay, праймер Urban Defence Complexion Primer, – универсальный вариант, если вы проводите лето в городе. Прозрачное средство с SPF не только подготовит кожу к нанесению макияжа и устранит видимые недостатки, но и обеспечит защиту от солнца.

Вернуться к оглавлению

Для чего нужен праймер для лица? – Блог NYX

Праймер — настоящий must have для качественного дневного или вечернего макияжа. Этот косметический продукт наносится под тональную основу и решает 3 основные задачи: фиксирует макияж, защищает лицо и делает эстетический результат более совершенным. Выбирать праймеры нужно с учетом нескольких особенностей — типа кожи, тона, особенностей тургора и микрорельефа. Мы расскажем, зачем нужны такие beauty-средства и как найти идеальное.

Виды праймеров

В первую очередь праймеры различаются по консистенции. Для жирной кожи лица нужны жидкие средства, например, NYX Professional Makeup Shine Killer или гелевый Honey Dew Me Up Primer. Они имеют легкую текстуру, которая создает невесомую основу под мейкап и служит защитным барьером. Проблема кожи этого типа заключается в том, что сальные железы работают слишком активно, а их выделения могут вступать в химические реакции с компонентами косметики, меняя их состав и цвет. Праймер такое развитие событий исключает: макияж не плывет, а воспаления эпидермиса становятся менее выраженными. Зачем отказывать себе в этом?

Для сухой кожи оптимальны праймеры мягкие, кремообразные, например, NYX Professional Makeup Soft Focus Primer. Они более плотные, нежные, благодаря густой текстуре улучшают микрорельеф сухой кожи — скрадывают морщины, увлажняют, подсвечивают.

Для зрелой кожи лица с заметными морщинами и признаками птоза нужны «шелковые» основы под макияж. Они содержат протеины, которые не только устраняют внешние несовершенства, но и улучшают состояние дермы в целом.

Праймеры и консилеры различаются также по базовому тону. Розовые убирают желтизну, зеленые маскируют покраснения, т.е. оптимальны для проблемной, склонной к раздражениям коже. Основы всех ходовых оттенков есть в линии NYX Professional Makeup Color Correcting Liquid Primer.

  • силиконовые праймеры — заполняют поры и морщины, создают идеально ровную базу под мэйкап, подходят и для нормальной, и для жирной кожи, могут использоваться как локально, например, для контура губ, так и для всего лица;
  • светоотражающие праймеры — содержат микрочастицы со светорассеивающей текстурой, благодаря которым лицо буквально подсвечивается изнутри, холодные тона хорошо подходят для светлой кожи, темные — для загорелой и смуглой;
  • минеральные праймеры — универсальный вариант для жирной кожи: матируют, абсорбируют сальные выделения без загрязнения пор, благодаря зеленому подтону скрывают покраснения.

Зачем нужен праймер для лица?

  • Благодаря ему пигменты и компоненты косметики не будут проникать внутрь пор, провоцируя их воспаление.
  • Основы делают макияж более стойким и исключают искажение цветов.
  • Базы любого тона сохраняют нормальный гидро-липидный барьер кожи.
  • С помощью праймеров легко скрыть несовершенства кожи, причем как незначительные вроде точечных покраснений, так и серьезные — прыщи, расширенные поры, следы от акне.
  • Праймер, как первый слой в одежде, обеспечивает комфорт: даже на очень сухой коже макияж через несколько часов не будет вызывать ощущение стянутости.
  • Все основы содержат фильтры, нивелирующие негативное воздействие ультрафиолета и предотвращающие фотостарение.
  • База для макияжа в разы упрощает контуринг лица: растушевки и переходы тонов выглядят аккуратными и естественными.
  • Праймер увлажняет кожу и при этом сохраняет матовый тон и бархатистую фактуру в течение всего дня.

Консилер или праймер?

У консилеров и основ под макияж есть общая «функция» — маскировать несовершенства кожи. Праймеры готовят кожу к использованию декоративной косметики: они наносятся до тонального крема, выравнивают оттенок, сглаживают морщинки, расширенные поры и шрамы.

Консилеры же применяются локально: прячут темные круги под глазами, маскируют точечные покраснения, пигментные пятна на лице и другие незначительные несовершенства. Такие косметические средства обычно имеют жидкую текстуру, а по тону максимально приближены к естественному цвету кожи. Консилер можно распределять поверх праймера в проблемных зонах.

5 полезных советов для тех, кто учится пользоваться праймером

  • Праймер используется только на предварительно подготовленную, чистую кожу.
  • Тональный крем наносится после полного высыхания базы, в противном случае он будет скатываться на сырой основе.
  • Матирующие праймеры должны быть прозрачными. На лице, склонном к жирному блеску, можно дважды проработать Т-зону, идеальный вариант — бесцветный жидкий NYX Professional Makeup Studio Perfect Primer.
  • Базы можно наносить локально: такие средства обычно имеют зеленый тон и предназначены для устранения покраснений и воспалений.
  • Основа — это всегда первый слой макияжа.
  • Качественная основа под макияж — не просто тренд: этот beauty-продукт улучшает состояние кожи и качество мейкапа. Он подходит для использования в течение всего года и совмещается с любыми декоративными косметическими средствами.

Что такое праймер для лица, как его выбрать и наносить правильно

Зачем нужен праймер для лица

Праймер помогает создать дополнительный слой между твоим лицом и макияжем, то есть это настоящая страховка, которая гарантирует, что тональный крем не поплывет через 5 минут после нанесения. Он создает защитный барьер для кожи, а также герметизирует и защищает любые средства для ухода.

В то время, как твой крем смягчает кожу, праймер подготавливает лицо к нанесению макияжа, продливая его жизнь и сохранность в течение дня.

Праймер для лица придет на помощь, если ты недовольна текстурой или пигментацией своего лица. А также, если твоя тональная основа не держится так долго, как хотелось бы.

Праймер для лица способствует более равномерному распределению тонального крема, аккуратной растушевке других продуктов, лучшей стойкости и передаче цвета любого средства макияжа, которое ты используешь на лице. Поэтому ответ на вопрос, зачем нужен праймер для лица, прост: для всего!

Профессиональные визажисты используют праймеры в качестве основы под макияж или же для того, чтобы облегчить текстуру и плотность любого тонального средства. Например, многие смешивают прозрачный матирующий праймер для лица с плотным тональным кремом — так текстура и цвет кожи будет более ровной, а на лице не будет эффекта маски.

Праймерами со светоотражающими частицами можно пользоваться и в качестве хайлайтера. Но это не все функции и виды праймеров.

Праймер для лица делает поры менее заметными, выравнивает текстуру и цвет лица, предотвращает появление жирного блеска, скрывает шелушения и помогает ровнее нанести тональную основу.

Цветные праймеры помогают справиться с неправильной пигментацией кожи. Например, персиковый и желтый маскируют синячки на лице. Зеленый праймер перекрывает красноту, сиреневый — серый оттенок кожи.

Как выбрать праймер для лица по типу кожи

Ориентируйтесь на свой тип кожи, берите в расчет и ее проблемы. Для сухой кожи нужна основа с увлажняющими компонентами, а для жирной нужна база без содержания масел и силиконов.

При расширенных порах пригодится праймер, заполняющий или сужающий их. Обладательницам жирной и комбинированной кожи можно наносить под тональное средство сухой праймер, который заполнит поры и будет впитывать жир и пот, не разрушая при этом макияж.

Девушкам с очень сухой кожей лучше обратить внимание на базы со светоотражающими пигментами — они придадут коже более здоровый, сияющий вид.

Если ты страдаешь от неравномерности тона, выбирай праймер с цветокоррекцией.

Также рекомендуется выбирать праймер, который будет сочетаться с твоей тональной основой. Например, матирующие праймеры редко сочетаются с ВВ, СС и DD-кремами, так как в последних и так есть компоненты, которые выполняют те же функции. Праймеры с силиконами, которые часто используются для нормального типа кожи с расширенными порами, не сочетаются с тональными основами с маслами. Тональный крем не сможет нормально «сцепиться» с кожей и пойдет пятнами. Вот, собственно, и вся инструкция для того, как выбрать праймер для лица. Дело за малым — научиться его использовать.

Как наносить праймер для лица

До праймера используй свой привычный дневной уход, включая солнцезащитное средство. А потом только наноси праймер.

  • Используй небольшое количество продукта: горошинки обычно хватает, чтобы полностью покрыть лицо. С праймерами, заполняющими поры стоит помнить, что их наносят только на проблемные участки. То есть, на Т-зону и область на щеках вокруг носа.

  • Двигайся от центра к периферии: визажисты рекомендуют все средства для кожи наносить от центра лица, где концентрируется основное внимание. Распределяй праймер тонким слоем круговыми движениями с помощью пальцев или же кисти, но не спонжа — он впитает много продукта.
  • Не забывай про зону вокруг глаз: ее тоже нужно подготовить к макияжу. Есть одно НО: не используй матирующий праймер на зоне под глазами, лучше нанеси туда базу для теней.
  • Смешай праймер с тональным кремом: так ты сократишь время нанесения мейкапа и получишь более стойкий и естественный макияж. Не смешивай праймеры для цветокоррекции с тональными кремами — только прозрачные или сияющие.

Лучшие праймеры для лица

Maybelline Baby Skin Instant Pore Eraser

около 100 грн

Это один из самых популярных праймеров, и мы можем понять почему. Производители не шутили, когда назвали его «Кожа ребенка», потому что он действительно приводит к этому мягкому бархатному чувству на коже. Праймер заполняет поры, увлажняет кожу и продлевает жизнь твоему макияжу.

Плюсы:

  • Легкий и нежирный
  • Делает кожу гладкой и увлажненной
  • Минимизирует появление морщин
  • Удобная для путешествий упаковка
  • Доступный

Минусы

  • Использование слишком большого количества может привести к жирному ощущению

Benefit POREfessional Face Primer

ок. 1500 грн

Его формула имеет шелковистую текстуру, которая помогает твоей тональной основе легко смешиваться и оставаться на месте в течение всего дня. Если твоя Т-зона очень жирная, он поможет контролировать маслянистость, а также будет держать сальный блеск в страхе.

Этот праймер подходит для всех оттенков лица и настоятельно рекомендуется для жирной, комбинированной и чувствительной кожи.

Плюсы:

  • Уменьшает морщины и поры
  • Легкий и нежирный
  • Подходит для всех типов кожи

Минусы

  • Если у тебя сухая кожа, он может не сработать

Lancome La Base Pro Primer

ок. 1000 грн

Праймер ощущается невероятно легким на коже и мгновенно увлажняет, придавая лицу здоровый вид. Если ты боретешься с жирной Т-зоной, эта формула, похожая на сыворотку, контролирует масло и предотвращает ужасный блеск. Кроме того, твой макияж будет длится дольше даже в жаркие дни.

Плюсы

  • Легко наносится
  • Сглаживает недостатки
  • Без масла

Минусы

  • Не подходит для очень жирной кожи

Clinique Superprimer

ок. 800 грн

Когда мы говорим о его текстуре, он похож на крем, но это не заставит твое лицо выглядеть или чувствовать себя жирным. Обогащенная антиоксидантами, эта некомедогенная формула отлично подходит для чувствительной кожи, а также делает ее увлажненной и здоровой.

Этот продукт от Clinique — лучший выбор для сухой кожи.

Плюсы:

  • Легкий и без масла
  • Прошел испытания на аллергию
  • Без запаха
  • Не сушит кожу

Минусы:

  • Не обеспечивает достаточного контроля масла для очень жирной кожи

Не нашла подходящий для себя? Вот еще варианты, среди которых ты точно что-то себе присмотришь!

Maybelline New York GiGi Collection Tinted Primer

Цена — 357 грн

L’Oreal Paris Infaillible Primer Base de Teint

Цена — 211 грн

Benefit The Porefessional Matte Rescue

Цена — 902 грн

Giorgio Armani Fluid Master Primer

Цена — 1226 грн

Yves Saint Laurent Touche Eclat Blur Primer Base De Teint Fluide

Цена — уточнять

Gosh Velvet Touch Prime’n Set Powder

Цена — 638 грн

Tarte Cosmetics Rainforest Of The Sea Radiance Drops

Цена — 863 грн

Праймер для лица. Для чего нужен и как использовать?

На чтение 5 мин.

Привет всем любителям качественной косметики! Всем нам нравится, когда кожа выглядит гладкой, ухоженной без каких-либо несовершенств. Конечно, существуют тональные основы и ББ-кремы, однако они не всегда полностью могут скрыть несовершенства, а в некоторых случаях даже подчёркивают их. Поэтому сегодня мы поговорим о праймере. Это именно то средство, которое поможет справится в данной ситуации. Так что же такое праймер? Какими свойствами он обладает? Давайте вместе ответим на эти вопросы!


Что такое праймер?

С английского это слово переводится, как «первичный». Как нетрудно догадаться, праймер наносится на кожу самым первым, является базой под макияж. Для чего? Всё просто: он является как бы фундаментом для последующих слоёв косметики, тем самым увеличивает стойкость макияжа. Но и это ещё не всё. Кроме того, что косметика на Вашем лице будет держаться значительно дольше, праймер также улучшает вид кожи: она выглядит более ровной и здоровой.

Какими свойствами обладает праймер?

Как мы уже упоминали ранее, праймер является прекрасной базой под тональник. Он отлично предотвращает макияж от скатывания. Это первое, но далеко не единственное его свойство.

Основным же свойством праймера является его способность разглаживать кожу. Продукт невероятно хорошо выравнивает рельеф кожи, устраняя такие мелкие недостатки, как расширенные поры. При этом, важно отметить, что праймер не забивает их. За счёт этого тональное средство более равномерно ложится на кожу, и макияж выглядит более естественным.

Ко всему прочему, праймер может скрывать небольшие покраснения и пигментацию. Конечно, он не заменит настоящий тональный крем, однако везучие обладательницы нормальной кожи без проблем могут использовать только праймер особенно в летний период.

Многие праймеры обладают также индивидуальными и очень даже неплохими свойствами. Например, есть праймеры, которые защищают кожу от ультрафиолета, а значит они предотвращают появление первых признаков старения кожи. Также есть праймеры, содержащие в себе различные полезные вещества. Они напитывают кожу витаминами, делая её более здоровой.


Читать также:

Консилер: что это и как его выбрать?


Виды праймеров:

Здесь производители по полной «разошлись», если можно так сказать. Праймеры бывают совершенно разные, с разными свойствами, и, выбирая подходящий, следует это учитывать.

№1. Сияющий праймер

Такой праймер содержит в себе особые светоотражающие частицы, которые придают коже желаемое сияние. Лицо выглядит увлажненным, свежим и здоровым. Но у многих людей эффект такого праймера ошибочно ассоциируется с жирным блеском, поэтому средство не пользуется особой популярностью. И очень даже зря. Сияющий праймер делает лицо более отдохнувшим и светлым.

№2. Кремовый праймер

Если Вы так и не смогли выбрать из всего обилия праймеров нужный именно Вам, то берите кремовый. Это средство подойдёт абсолютно любому типу кожи. Оно прекрасно увлажняет и является просто идеальной базой под макияж: тон ложится легко и равномерно.

№3. Матирующий праймер

Как понятно из названия, такой праймер отлично подойдёт жирной и проблемной коже. Регулируя работу сальных желез, средство избавляет кожу от ненавистного жирного блеска, совершенно не забивая при этом поры.

№4. Силиконовый праймер

Не волнуйтесь, силикон не всегда плохо! В данном случае это даже отлично. Силиконовый праймер бесцветен и предназначен для разглаживания рельефа лица. Он идеально выравнивает кожу, а также сужает поры. Тональник ложится равномерно, кожа выглядит гладкой и шелковистой. При выборе силиконового праймера следует учитывать тип кожи. Средство отлично подойдёт жирной и возрастной коже, но обладательницам проблемной придётся сразу отказаться от такого праймера.

№5. Праймер на масляной основе

Такое средство не просто является отличной основой под макияж. Оно ещё и ухаживает за кожей, делает её более увлажнённой и эластичной, выравнивает морщинки. Праймер на масляной основе очень универсален. Прекрасно сочетая в себе и декоративные, и уходовые функции, он благоприятно влияет и на вид кожи, и на её состояние.

№6. Жидкий праймер

Праймер в виде лосьона обладает невесомой текстурой, что делает его абсолютно не похожим на другие. Он совершенно не чувствуется на лице и при этом отлично увлажняет кожу, выравнивает тон. Более всего такое средство подходит жирной и комбинированной коже.

№7. Зелёный праймер

Единственный праймер, который наносится точечно. Этим он больше напоминает консилер. Такой праймер идеально скрывает покраснения и воспаления. С ним кожа точно будет выглядеть гладкой и мягкой.

Выбирая праймер, всегда учитывайте его вид и тип Вашей кожи! Неправильно подобранное средство может плохо повлиять на Вашу кожу!

Использование праймера:

Для начала следует подготовить кожу к нанесению косметики вообще. Что для этого нужно? Увлажните кожу. Это можно сделать при помощи крема для лица или эмульсии. Для чего это нужно? Так косметика будет наноситься ровно, а макияж дольше держаться.

Следующим шагом мы наносим праймер. Матирующий праймер по оттенку должен совпадать с кожей. Наносите средство по всему лицу (исключением является зелёный, им покрывают только проблемные зоны). Сначала выдавите праймер на ладонь. Теперь влажным спонжем либо кистью круговыми движениями нанесите на лицо. Равномерно распределяйте от области глаз к носу, щекам, лбу, подбородку.

Удостоверьтесь, что Вы равномерно нанесли средство на лицо. Особенно обратите внимание на Т-зону. В случае необходимости нанесите праймер повторно постукивающими движениями в проблемных зонах. Подождите, когда средство подсохнет и можете накладывать оставшуюся косметику.


Рекомендуем:

Праймер для лица — что это, для чего нужен, как пользоваться

За 7 лет ведения блога и не одной статьи про то, зачем нужен праймер для лица . А действительно, что такое праймер и для чего он нужен?


Если вы оказались в корнере и вам предлагают купить праймер для лица (не путать с праймером для глаз) – не торопитесь. Жить без него можно, а некоторым нужно.

Праймер для лица – это база под макияж, которая подготавливает кожу к нанесению тонального крема.

Задумка у него хорошая, а вот реализация так себе:

  • Он обещает продлить стойкость макияжа, но делает это не всегда.
  • Уверяет нас в том, что он незаменим, ах, если бы так оно и было.
  • Говорит, что решит проблемы кожи, но делает это далеко не на 100%, а иногда даже не на 50%.

Верить ему сложно, так как качества праймера для лица слишком преувеличены. А оно и понятно: купил тональный крем – покупай и праймер. Отличный маркетинговый ход.

Тем не менее некоторые виды праймеров упрощают жизнь и способны улучшить качество макияжа. Например для сухой кожи. Мой топ-3 вы узнаете из статьи “Лучшая база под макияж для сухой кожи“.

Виды праймера для лица

Производителям косметики было недостаточно создать просто праймер. Они дополнили это категорию несколькими подвидами праймера:

  • со светоотражающими частичками
  • цветокорректирующий

От типа кожи зависит какой праймер вам нужен – матирующий или увлажняющий. Как не ошибиться с выбором я рассказала в статье “Как выбрать праймер для сухой, жирной, комбинированной кожи“.

Сыворотка или дневной крем – тоже работают как праймер для лица. Отсюда путаница и лишние траты.

Поэтому прежде чем покупать праймер, попробуйте обойтись уходом. Если он заменит качества праймера, то живем спокойно и игнорируем популярность этого средства. А она в последние годы тааак возросла, что даже стыдно задать вопрос: а что такое праймер?

Матирующий праймер тоже не всесилен. Многие жалуются на эффект “что с ним, что без него – разницы никакой” . Если и вы ее не почувствовали, а точнее, не заметили разницы, то лучше отказаться от такого бесполезного продукта, как праймер!

Не дайте себя убедить в необходимости того, что не работает для вас или дает сомнительный результат.

Вот вы, чувствуете разницу с праймером для лица и без него?

 

Для чего нужен Праймер и как его наносить

Для чего нужен Праймер и как его наносить

14.08.2020

Праймер — это один из тех «пограничных» продуктов, которые действуют на стыке ухода за кожей и макияжа. Именно поэтому у покупателей часто возникает вопрос, нужен ли Праймер на самом деле или это очередная уловка маркетологов.

Независимо от того, предпочитаете  вы естественное состояние кожи или используете основу под макияж, мы  хотим рассказать об этом  важном продукте, чтобы исключить непонимание и показать место Праймера в процессе создания образа.

Итак, что такое Праймер?

Праймер — это основа для ровного и стойкого макияжа. Качественный Праймер может содержать активные увлажняющие, питательные и антиэйдж-ингредиенты, однако он не равен по своему действию уходовому крему, и вот почему.  Крем, в зависимости от своего состава, оказывает коже ту или иную поддержку, НО! не заполняет поры и мелкие морщинки, создавая гладкую, ровную поверхность так, как это делает Праймер.

Праймеры можно подобрать по типу кожи или для решения конкретных проблем. Например, существуют  матирующие праймеры для жирной кожи с  расширенными порами, увлажняющие праймеры для сухой или зрелой кожи и даже праймеры для коррекции цвета, которые маскируют покраснения и пигментные пятна.

Лучше избегать праймеров, содержащих силикон (диметикон). Силикон отлично  заполняет  поры, но он же и забивает их! Силикон трудно удалить с кожи, к нему легко присоединяются пыль, грязь и кожное сало, что приводит к расширению пор и воспалению. Кроме того, силикон создает на коже пленку, которая препятствует усвоению ухаживающих компонентов, в результате кожа становится обезвоженной, нарушаются ее естественные физиологические функции.

Как наносить праймер?

Праймер можно наносить локально на проблемные участки или в качестве сплошной основы. Можно использовать кисть или влажный косметический спонж, но лучше всего наносить Праймер, как и уходовый крем, подушечками пальцев. Слегка согревшись  в руках, Праймер легко и естественно заполнит морщинки и подготовит идеальную основу под макияж.  

Что такое праймер для век, и нужен ли он вам?

Как сделать оттенок теней чище и ярче и заставить их держаться целый день, даже если на улице жарко? На это способны праймеры для век, и эти «фокусы» они одинаково хорошо выполняют и с тенями, и с гелевыми подводками, и с другими продуктами для макияжа глаз.

За счет чего работают праймеры для век, и в каких случаях их применение необходимо? На эти и другие вопросы отвечаем вместе с экспертом Posta-Magazine.

Валерия Овчинникова, официальный визажист бренда Bespecial

Что такое праймер для век, и как он работает?

Праймер-база под тени — это средство 2 в 1, которое предназначено, чтобы выровнять тон кожи век и устранить цветовые дефекты (венки, пигментные пятна), а также усилить стойкость и передачу цветов продуктов, которые наносятся после: тени, помадки, лайнеры, гелевые подводки и другие средства.

Какие задачи решает праймер для век?

Подготавливает кожу к нанесению макияжа глаз. Если пропустить этап с праймером-базой, тени могут начать осыпаться, плохо тушеваться или наноситься не очень равномерно. Плюс праймеры для век усиливают пигмент любых теней, сохраняют их яркость и фактурность. Цвет праймера может сразу задать цветовую основу для дальнейшего макияжа глаз, например, если макияж nude, то база должна быть прозрачной или бежевой, если же макияж цветной, то и цвет базы должен сочетаться оттенком с общей композицией макияжа глаз.

Как правильно пользоваться праймером для век?

В зависимости от консистенции праймер можно наносить кистью или подушечками пальцев. Второй вариант более предпочтителен, если для вас важно нанести средство тонким слоем и не допустить появления ни единого комочка.

За счет чего работает праймер для век?

Чаще всего праймеры работают за счет содержания определенного количества силиконов и других стойких компонентов, которые блокируют выработку кожного сала и держат тени в течение всего дня на веке. Использовать в качестве праймера консилер, тональный крем или другие продукты не совсем правильно. Это важно понимать, так как продукты, созданные для других участков кожи лица, могут выполнять абсолютно противоположные функции и содержать компоненты, предназначенные для решения других задач в макияже.

Есть ли у этих продуктов показания и противопоказания к применению?

К противопоказаниям можно отнести индивидуальную непереносимость отдельных компонентов средства, сильную сухость век, которая сопровождается шелушением и связана с обезвоживанием организма или кожными заболеваниями. В этом случае наносить какие-либо косметические средства на глаза не рекомендуется. Нужна база для век, если вам важно, чтобы макияж оставался свежим и ярким в течение всего дня, если вы делаете насыщенный многослойный макияж. И еще несколько ситуаций, когда праймер необходим — это жирная кожа и особое строение кожи век, так называемая «падающая складка», которая часто «съедает» тени и смазывает их.

Что делает праймер? 6 причин, по которым вам нужен праймер для макияжа

by LovelySkin | 28 июля 2020 г.

Для чего нужен праймер? Это вопрос, который мы получаем постоянно. Если вам интересно, действительно ли вам нужен праймер для макияжа, мы ответим абсолютно! Вот почему:

1). Праймер для макияжа создает нечто, к чему ваша база «прилипнет», чтобы она держалась.

Праймер для макияжа

станет вашим лучшим другом, если вы хотите, чтобы макияж выглядел свежим в течение всего дня.Кто этого не хочет?

Бонус: Это также отличный способ получить дополнительный SPF. Не каждый праймер содержит солнцезащитные ингредиенты, но некоторые из них! Нам нравится La Roche-Posay Anthelios 50 Daily Anti-Aging Primer с солнцезащитным кремом, потому что он предлагает SPF 50, а также антиоксиданты, которые помогают лечить и предотвращать преждевременные признаки старения.

2). Праймер для макияжа обладает уникальной шелковистой текстурой и превосходными разглаживающими свойствами.

Большинство праймеров содержат полимеры на основе силикона, которые не только придают им шелковистость, но и позволяют заполнять любые углубления на коже.Это включает в себя большие поры, тонкие линии, морщины и легкие рубцы от прыщей.

jane iredale Smooth Affair Facial Primer & Brightener не только создает безупречную основу, но также помогает осветлить и осветить вашу кожу, придавая ей сияющий вид изнутри. Экстракты водорослей укрепляют и удерживают влагу, а алоэ успокаивает покраснение.

3). Праймер также необходим для ваших глаз.

Отличная грунтовка для век поможет предотвратить образование складок теней и удержит их на месте в течение всего дня.Теперь доступный в шести оттенках, jane iredale Smooth Affair for Eyes можно носить отдельно или под любимым макияжем глаз, чтобы цвета выделялись и не растекались.

4). Праймер под макияж предназначен не только для макияжа всего лица.

Это правда, что основная цель праймера для макияжа — создать гладкую, стойкую основу для вашего любимого макияжа лица, но вы обнаружите, что он также пригодится, когда вы просто хотите размыть недостатки и контролировать блеск.

Поднимите минималистичный макияж на новый уровень с помощью Glo Skin Beauty Tinted Primer SPF 30. Он даст вам достаточно эффекта размытия кожи, сохраняя при этом чистый и легкий вид (и ощущение).

5). Праймер под макияж лучше всего подавать теплым.

Под этим мы подразумеваем, конечно, согретый в руке! Разотрите праймер между ладонями или на тыльной стороне ладони, чтобы осторожно нагреть, а затем нанесите его пальцами. Тепло позволяет продукту «растаять» на вашей коже и обеспечивать естественный результат.

Нам нравится Dermablend Poresaver Matte Makeup Primer, потому что он матирует кожу, впитывая излишки масла и сужая поры. Кроме того, он не вызывает комедонов, поэтому не усугубит угревую сыпь и не вызовет высыпаний!

6). Можно смешать праймер «коктейль» и многозадачность.

Праймер для макияжа можно смешивать с вашей любимой жидкой основой для более гладкого покрытия, которое по-прежнему сохраняет стойкость. Просто согрейте немного праймера на тыльной стороне ладони и по капле добавляйте основу, пока не получите консистенцию и цвет, которые подходят именно вам.

Наша любимая формула для многозадачности — это Youngblood Mineral Primer. Это, вероятно, само собой разумеется, но эта бесцветная основа без парабенов также прекрасно подходит для использования в качестве обычного праймера — она ​​богата витаминами и минералами, которые помогают защитить кожу от воздействия окружающей среды.

У вас есть вопрос по поводу назначения праймера под макияж? Дайте нам знать в комментариях ниже или расскажите нам в Facebook, Twitter или Instagram, используя #LovelySkin!

Что такое праймер для макияжа и для чего он нужен?

Любите ли вы наносить макияж на все лицо каждый день или предпочитаете более упрощенный подход к красоте, праймер может стать лучшим новым дополнением к вашей косметичке.Если вы совершенно не пользуетесь грунтовкой, вы не одиноки! В большинстве случаев мы либо не знаем, как им пользоваться, либо просто не думаем, что нам это нужно. Чтобы получить более подробную информацию о важности праймера, мы поговорили с визажистом из Нэшвилла Челси Рейнольдс, которая создает образы для моды, красоты и специальных мероприятий.

Что такое праймер для макияжа?

Праймер для макияжа — это крем, гель или жидкость, предназначенные для создания гладкой основы под макияж. Как и ваш тональный крем, он бывает разных оттенков — росистый, атласный или матовый — и заполняет поры, впитывает излишки масла и выравнивает текстуру кожи, благодаря чему тональный крем остается более гладким, выглядит более естественным и держится намного дольше.Некоторые праймеры для макияжа обеспечивают небольшое покрытие мелких недостатков кожи, а некоторые обеспечивают дополнительные преимущества ухода за кожей, такие как увлажнение, антивозрастность и защита от солнца, чтобы улучшить вашу кожу в долгосрочной перспективе.

Однако праймеры

наносятся не только на тональную основу — они выходят за рамки макияжа. Вот разные типы праймеров, для чего они нужны и зачем они вам нужны.

  1. 1.Праймер для тонального крема: создает гладкую основу для тонального крема

    Подумайте об использовании грунтовки для фундамента так же, как о грунтовке под краску для вашего дома. Цель состоит в том, чтобы создать гладкое базовое покрытие перед нанесением последнего слоя. «Праймер не только обладает дополнительными преимуществами для кожи, такими как увлажнение и контроль жирности», — объясняет Рейнольдс, — «он обеспечивает основу для приклеивания макияжа. Праймер действительно увеличивает стойкость макияжа и предотвращает образование складок в течение дня.«Праймеры
    Foundation не универсальны, и не все из них обладают одинаковыми преимуществами. Чтобы помочь вам найти подходящую основу для основы, всегда разумно учитывать ваш тип кожи и проблемы. Чтобы создать легкий, солнцезащитный и улучшающий цвет холст, попробуйте Colorescience Skin Perfector Brighten Primer SPF 20.

    Купить сейчас с бесплатной доставкой
  2. 2.Праймер для век или теней: предотвращает образование складок в тенях

    Вы замечаете, что в течение дня ваши веки становятся немного жирными? Вы когда-нибудь замечали, что ваши тени стали складками или пигмент тускнеет слишком быстро? Праймер для век может быть именно тем, чего не хватает в вашем обычном макияже. «Праймер для век не только усиливает пигментацию тени, но и предотвращает образование складок», — говорит Рейнольдс. «Праймеры для век позволят макияжу глаз плавно ложиться и сохранят его стойкость в течение дня.”
    В качестве увлажняющего праймера, который также можно использовать как средство для ухода за кожей вокруг глаз, попробуйте осветляющий праймер для век Jouer Cosmetics Long-Wear Eye Brifying Primer.

    Купить сейчас с бесплатной доставкой
  3. Купи сейчас с Dermstore

    3.Праймер для ресниц: делает ваши ресницы гуще и длиннее

    Если вы ищете более сильные и густые ресницы (не так ли?), Праймер для ресниц — отличный выбор для вас. Праймер для ресниц удлиняет ресницы, а в некоторых случаях также может стимулировать их рост. Кроме того, он создает приятную основу для туши, благодаря которой она держится дольше. Рейнольдс говорит: «Мне нравится праймер для ресниц, потому что он отлично подходит для кондиционирования ресниц и подготовки их к нанесению туши.”
    Чтобы улучшить ваши ресницы от корней до кончиков, мы рекомендуем PureLash Extender и Conditioner от jane iredale.

    Купить сейчас с бесплатной доставкой
  4. Купи сейчас с Dermstore

    4.Праймер для ногтей: защищает ногти и делает лак долговечным

    Праймер

    предназначен не только для совершенствования нашего макияжа. Праймер также может изменить правила игры для наших ногтей. Этот универсальный продукт помогает лаку держаться дольше и защищает ногти от сколов. «Мне нравится праймер для ногтей, потому что он помогает укрепить мои ногти и защитить их от лака, так что не будет обесцвечивания», — говорит Рейнольдс.
    Наш любимый стойкий праймер для ногтей — это Smith & Cult’s Basis of Everything.

    Купить сейчас с бесплатной доставкой
  5. Купи сейчас с Dermstore

    5.Праймер для волос: защищает волосы от жары и влажности

    Праймер для волос создает барьер, помогающий защитить волосы от тепловой укладки, влажности и других факторов. «Праймеры для волос отлично подходят для создания дополнительного слоя защиты», — объясняет Рейнольдс. Она также рекомендует использовать праймер для волос, чтобы «свести к минимуму тепловое или химическое повреждение».
    Некоторые праймеры для волос, такие как TWISTER Curl Primer от R + Co, также придают волосам влагу и четкость, защищая их от теплового повреждения.

    Купить сейчас с бесплатной доставкой

Определение грунтовки по Merriam-Webster

прим · эр | \ ˈPri-mər , главным образом британские ˈprī-m \

1 : небольшая книга для обучения детей чтению

2 : небольшая вводная книга по предмету

3 : краткое информативное письмо

прим · эр | \ Prī-mər \ 1 : Устройство для заливки особенно : колпачок, трубка или пластина, содержащие ударный порошок или состав, используемые для воспламенения заряда взрывчатого вещества. 2 : Материал, используемый для грунтовки поверхности.

— также называется грунтовка

3 : молекула (например, короткая цепь РНК или ДНК), присутствие которой требуется для образования другой молекулы (например, более длинной цепи ДНК).

Что такое праймер для макияжа и как использовать праймер для лица

Не зря праймеры были в центре внимания.Но все же есть немало людей, которые не совсем понимают истинное предназначение праймера в макияже и почему и как использовать праймеры для макияжа. Многие из нас не владеют праймером или просто спрашивают, что такое праймер, когда слышат его впервые. Кроме того, многие пропускают этот шаг, считая его несущественным, а многие просто избегают его, потому что не знают, как его использовать. Как и у любого продукта в макияже, у праймера тоже есть цель, и она действительно очень благородная.

Назначение праймера под макияж

Основное назначение праймера — разглаживать кожу, делая ее более гладкой и гладкой.Считайте это подготовкой кожи к созданию холста для макияжа, который вы будете наносить на лицо. Праймер заполняет поры, стирает пятна и придает коже гладкость. Праймер можно рассматривать как основу, которая придает макияжу особую стойкость. Он защищает кожу, действуя как барьер, а также помогает макияжу держаться дольше

Типы праймеров

Теперь, когда вы узнали, что такое праймер и его назначение, вы должны быть знакомы с типами доступных праймеров и с тем, что каждый из них может предложить. уникально, чтобы вы могли найти идеальную грунтовку в соответствии с вашими потребностями.

Гель-праймер — Гель-праймер идеально подходит для сухой кожи, так как цель этого праймера — сохранить кожу увлажненной и придать ей гладкость. В настоящее время вы получаете гиалуроновую кислоту и антиоксиданты в гелевых праймерах для более эффективных результатов.

Тонированная грунтовка — грунтовка этого типа может быть в гелевой или жидкой форме с легким оттенком. Тонированные праймеры используются для прозрачного покрытия кожи, которое скрывает тонкие линии и морщинки на лице.

Праймер на кремовой основе — Текстура этого праймера будет кремовой, что идеально подходит для лучшего покрытия и хорошего смешивания, обеспечивая пигментацию на один оттенок лучше, чем тонированные.

Силиконовая грунтовка — этот тип грунтовки обеспечивает гладкую поверхность холста, как финишную поверхность. Это альтернатива грунтовкам на водной основе. Это помогает макияжу держаться дольше.

Праймер для глаз. Также существует праймер для глаз, так как для правильного нанесения макияжа глаз требуется специальное нанесение.В основном этот праймер помогает в коррекции цвета век перед нанесением макияжа.

Праймер для губ — Наши губы со временем теряют естественный цвет и становятся бледными, чтобы обуздать эту проблему, наносится праймер для губ, чтобы подготовить основу для нанесения помады. Это, в свою очередь, помогает помаде держаться надолго и в лучшем случае возвращает пигмент оттенка.

Праймер для ногтей — Для всех ваших любимых нейл-артов вам необходимо нанести праймер для ногтей перед нанесением цвета на ногти.Слой грунтовки для ногтей защитит лак для ногтей и увеличит стойкость лака.

Как выбрать праймер под макияж?

Когда дело доходит до покупки подходящей грунтовки для себя, недостаточно знать о грунтовке. Если вы ищете праймер для лица или праймер для макияжа и не знаете, как выбрать праймер? Следуйте этим рекомендациям.

Выбор праймера должен основываться на двух вещах: типе кожи и оттенке кожи, поэтому важно знать все о праймере, относящемся к вашему тону и типу кожи.

Сухая кожа

Если у вас сухая кожа, главное, чтобы ваша кожа оставалась увлажненной и увлажненной. Людям с сухой кожей необходимо попробовать супергидратирующий праймер, который впитывается в вашу кожу, сохраняя ее увлажненной и увлажненной. Праймер на масляной основе также подходит для этого типа кожи.

Жирная кожа

Если у вас жирная кожа, вы не можете точно выбрать праймер на масляной основе, так как этот тип кожи выделяет дополнительное кожное сало и, следовательно, вам нужен матирующий праймер, который является праймером, дающим матовый эффект, поскольку он помогает макияж держится дольше.

Комбинированная кожа

Комбинированная кожа — это все о том, что определенные участки лица могут быть как жирными, так и сухими. В таких случаях вы можете использовать комбинацию праймера для жирной кожи и праймера для сухой кожи на соответствующих участках.

Кожа, склонная к акне

Этот тип кожи требует праймера больше всего, поскольку вы имеете дело с жирностью и чувствительностью кожи. Кожа, склонная к прыщам, готова к высыпанию в любой момент, если не лечить должным образом.Макияж иногда может представлять угрозу для кожи, склонной к акне, и поэтому праймер перед нанесением макияжа играет здесь важную роль. Нужно подобрать безмасляный праймер или гелевый праймер, который быстро впитывается, создавая гладкую и идеальную основу для макияжа.

Когда использовать грунтовку?
  • Использование праймера для макияжа создает гладкую поверхность и безупречный вид.

  • После процедуры CTM нанесите праймер, а затем тональный крем или BB-крем.

  • Можно даже наносить праймер отдельно, если вы просто хотите уменьшить поры и не хотите накладывать макияж.

  • Просто нанесите грунтовку и закрепите с помощью фиксирующей пудры или компакта для естественного вида.

Как использовать праймер для макияжа? №

Праймер предназначен для нанесения на чистую и увлажненную кожу. Перед нанесением праймера обязательно используйте подходящий увлажняющий крем. Подождите несколько минут и позвольте увлажняющему крему проникнуть в кожу, прежде чем начинать наносить ее.

  • Возьмите пальцем небольшое количество продукта и нанесите его на все лицо или только на участки с очень большими порами.

  • Это будут жирные участки, которые не позволяют макияжу держаться долго. Нос, подбородок и лоб — самые частые проблемные зоны. Также хорошо заметны крупные поры на щеках.

  • Теперь нанесите праймер на все лицо и аккуратно втирайте его в кожу круговыми движениями (при нанесении крема или увлажняющего крема).

  • Не будьте резкими и не используйте слишком много продукта. Принимайте минимальное количество за раз и продолжайте добавлять продукт при необходимости.

  • Всегда помните, когда дело касается макияжа, меньше значит лучше.

Каковы наиболее распространенные ошибки праймера?

Сделать правильный макияж и выглядеть красиво может быть проще, чем поддерживать макияж в течение длительного времени или в течение дня. Поэтому праймер здесь становится спасителем макияжа.Primer подготовит идеальную основу в виде холста, чтобы ваш макияж держался дольше. Часто мы делаем ошибки, когда не знаем, что можно и чего нельзя. Этапы нанесения праймера различаются в зависимости от того, какой продукт вы будете использовать в макияже. Итак, вот руководство, как избежать распространенных ошибок Primer.

  1. Использование неподходящего праймера. Когда вы не имеете представления о типе и состоянии вашей кожи и выбираете праймер на основе желаемых результатов, вы можете совершить ошибку, выбрав неправильный праймер.Поэтому важно знать, в каком состоянии ваша кожа, прежде чем выбирать грунтовку.

  1. Нанесение основы сразу после грунтовки — одна из распространенных ошибок — наносить основу сразу после грунтовки. Прежде чем приступить к работе, грунтовке необходимо несколько минут, чтобы она осела на коже, поскольку она обеспечит гладкую основу, позволяющую легко позолочить продукты.

  1. Без праймера для глаз — Макияж для глаз играет важную роль, поскольку он находится в центре внимания всего лица.Часто у вас может быть жалоба на то, что макияж глаз не держится в течение длительного времени, поэтому не следует пропускать нанесение праймера для глаз, прежде чем продолжить.

  1. Нанесение лишнего или небольшого количества — Еще одна распространенная ошибка, которую вы можете сделать, — это нанести чрезмерное или небольшое количество праймера, не зная, насколько он нужен вашему лицу для выполнения работы. Слишком много праймера будет скользить по вашему макияжу и мешать нанесению. Слишком мало грунтовки не имеет смысла в грунтовке, поскольку ее недостаточно для правильной подготовки основания.

Посмотрите и узнайте, как использовать праймер для макияжа: если вы все это время задавались вопросом, как использовать праймер для лица, то вам нужно нажать на ссылку и узнать, как наносить праймер.

QNA

Как использовать праймер для лица для стойкого макияжа?

Indeed Primer помогает сохранить продукт в течение более длительного времени, и к этому нужно знать, как это сделать. Это включает всего два шага. Сначала вам нужно очистить лицо хорошим умыванием, а затем нанести увлажняющий крем.Когда ваша кожа будет готова, нанесите небольшое количество праймера на тыльную сторону руки и кончиками пальцев начните растушевывать от центра носа к краям, пока не будут покрыты все области. Подождите несколько минут, пока грунтовка осядет, а затем переходите к следующему этапу нанесения основы.

Действительно ли работают праймеры для лица?

Face Primer создает гладкую основу и текстуру для идеального нанесения макияжа. Существуют различные типы грунтовки в зависимости от состояния кожи, например, увлажняющая грунтовка для сухой кожи и матирующая грунтовка для кожи на масляной основе.Его основное предназначение — дольше удерживать макияж и не допускать выцветания. Наряду с этим, он помогает в нанесении макияжа, поскольку дает основу для идеального скольжения макияжа.

Что делает праймер для лица?

Face Primer — это холст, похожий на основу для макияжа, обеспечивая гладкое нанесение. Это помогает легко скользить, придавая вам желаемый вид, который может оставаться в течение длительного времени. Он также придает сияющий вид и улучшает текстуру кожи, что дает дополнительные преимущества для всего вашего макияжа.

Подробнее

Три мифа о праймерах под макияж: знаете ли вы эти мифы о праймерах? Если нет, сразу проверьте их, чтобы узнать правду.

Как использовать Face Primer: Вы все еще придерживаетесь грунтовки для лица? Ознакомьтесь с этим руководством, чтобы узнать, как использовать праймер для макияжа.

Нанесение грунтовочного слоя перед покраской

Слой грунтовки рекомендуется практически для всех проектов окраски, будь то новый гипсокартон, старое дерево, голый металл, ранее окрашенный кирпич или любая другая поверхность.Грунтовка представляет собой липкую плоскую краску, которая должна хорошо держаться и обеспечивать однородную основу для верхних слоев краски. Если вы красите поверхность без предварительного грунтования, вам, вероятно, потребуется больше слоев для адекватного покрытия, и краска может не прилипать к исходной поверхности так же хорошо, как к грунтовке. Существуют разные рецептуры грунтовки, предназначенные для разных поверхностей.

Преимущества грунтовки

Нанесение грунтовки на новые поверхности обеспечивает герметизацию исходного материала, так что краска не впитывается в него, что требует дополнительных слоев.Грунтовка также помогает скрыть стыки или швы на новом гипсокартоне и предотвращает просачивание сучков и других естественных дефектов и окраски на голой древесине. Грунтовка со свойством блокирования пятен герметизирует пятна плесени и другие пятна обесцвечивания, чтобы они не проступали через финишные слои краски. Грунтовка, наносимая на кирпичную кладку, металл и многие деревянные поверхности, необходима для надлежащего приклеивания краски.

Грунтовка обычно белого цвета, но может быть и других нейтральных цветов. Это должно обеспечить нейтральную поверхность, чтобы цвета краски отображались правильно.Саму грунтовку окрашивать не нужно, но некоторые магазины красок добавляют в грунтовку небольшое количество пигмента, чтобы приблизить ее к окончательному цвету краски. Это хорошая идея, когда конечный цвет намного светлее исходного цвета поверхности.

Грунтовки на масляной основе

Грунтовка на масляной основе часто рекомендуется для поверхностей, к которым можно прикасаться, таких как двери, окна и шкафы. Грунтовки на масляной основе требуют уайт-спирита для разбавления и очистки.Они отлично подходят для герметизации проблемных пород дерева, таких как кедр. Грунтовки на основе шеллака предназначены для покрытия самых сложных поверхностей, включая пятна от дыма, мелки и клеи на масляной основе.

Грунтовки на водной основе

Праймеры на водной основе, или «латексные», отлично подходят для блокирования пятен и даже лучше, когда на поверхности есть участки, заполненные пастой. Они обеспечивают отличную гибкость отделки с отличным сопротивлением растрескиванию и рекомендуются для использования на новом гипсокартоне и голой древесине.Перед нанесением грунтовки на водную основу для голой древесины проверьте ее на незаметном месте, чтобы убедиться, что она не поднимает волокна древесины. Многие грунтовки на водной основе также можно использовать для штукатурки, кирпичной кладки, кирпича и окрашенного металла, в зависимости от конкретной формулы. Как правило, более качественные грунтовки на водной основе используют 100-процентные акриловые смолы и стоят немного дороже, чем формулы стандартного качества.

Краска и грунтовка в одном

Краска-грунтовка в одном продукте предназначена для герметизации и покрытия поверхностей в один слой.Эти продукты лучше всего подходят для нового гипсокартона или ранее окрашенных поверхностей и могут обеспечить хорошее покрытие в один слой. Однако их формулируют скорее как густую краску, чем как грунтовки. Это означает, что они могут не работать так же хорошо, как настоящий праймер во многих ситуациях. На поверхностях, требующих высокой адгезии, блокирования пятен или герметизирующих свойств настоящей грунтовки, не рекомендуется использовать лакокрасочную грунтовку.

Как создать собственный праймер? | Часто задаваемые вопросы по секвенированию / фрагментному анализу по Сэнгеру

Одним из наиболее важных факторов успешного автоматического секвенирования ДНК является правильный дизайн праймера.В этом документе описаны этапы этого процесса и основные подводные камни, которых следует избегать.

**** Используйте компьютер для разработки праймеров ****

Мы настоятельно рекомендуем использовать компьютер при проектировании грунтовки для проверки некоторых критических дефектов конструкции. Многие программы могут выполнять этот анализ. Например, поищите в Интернете «Primer3».

Некоторые основные концепции: Если вас смущают нити и ориентация праймера, прочтите это.

Праймеры для секвенирования

должны иметь возможность отжига с целевой ДНК в предсказуемом месте и на предсказуемой цепи. Кроме того, они должны быть способны к удлинению с помощью ДНК-полимеразы Taq.

Некоторые люди не понимают, как исследовать последовательность ДНК, чтобы выбрать подходящую последовательность праймера. Вот несколько вещей, которые следует запомнить новичкам:

  • Последовательности всегда записываются от 5 ‘до 3’. Это включает последовательность вашей матричной ДНК (если она известна), последовательность векторной ДНК, в которую она вставлена, и последовательность предложенных праймеров .Никогда не пишите последовательность праймеров в обратном порядке, иначе вы только запутаете себя и других.
  • Полимераза
  • всегда расширяет 3′-конец праймера, и последовательность, которую вы будете читать, будет той же цепи (смысловой или антисмысловой), что и сам праймер .
  • Таким образом, если вы выберете последовательность праймера, которую вы можете прочитать в исходной последовательности (например, в векторе), полученная последовательность будет простираться от правого (3 ‘) конца праймера.
  • И наоборот, если вы выберете праймер из цепи, противоположной тому, что читает ваша «исходная» последовательность, результирующая последовательность будет читаться влево .| | BamHI EcoRI

    Если вы клонировали интересующую вас ДНК между сайтами BamHI и EcoRI, вы можете секвенировать с помощью праймера «CTTGATGCTAGTACTACATC» (помните — это написано от 5 ‘до 3’), и вы получите следующую последовательность из ядра:

     TAGTGCTAGATG [your-insert-'top'-strand-Bam-to-Eco] AATTCGCTGATGC...(так далее.)
     

    Что, если вам нужна последовательность из другой цепочки — от Eco до Bam — вместо этого? В этом случае вам нужно выбрать некоторую последовательность справа , а затем дополнить ее обратным дополнением , прежде чем запрашивать олигонуклеотид. Выбираем последовательность из рисунка выше:

     CTGATGCTCATATGTTAATA
     

    Это НЕ последовательность праймера — она ​​дословно скопирована из указанной выше последовательности. Фактически, если вы использовали эту последовательность в качестве праймера, секвенирование продолжалось бы на вправо, от вставки .Вместо этого дополните эту последовательность в обратном порядке:

     TATTAACATATGAGCATCAG
     

    ТЕПЕРЬ это должно произвести последовательность противоположной нити:

     CGAATT [your-insert-'bottom'-strand-Eco-to-Bam] CATCTAGCACTA ... (и т. Д.)
     

    Мелкий шрифт: лишь в редких случаях при секвенировании действительно обнаруживаются нуклеотиды, расположенные непосредственно после праймера. Я получил некоторую дидактическую лицензию в приведенных выше примерах.


Более сложные концепции: как разработать эффективный грунт.

Обычно вы начинаете с небольшого количества известной последовательности, которую хотите расширить. Вот как действовать:

I. Конструируйте праймеры только на основе точных данных о последовательности.
Автоматическое секвенирование (и фактически любое секвенирование) имеет конечную вероятность возникновения ошибок. Последовательность, полученная слишком далеко от праймера, следует рассматривать как сомнительную. Чтобы определить, что «слишком далеко», мы настоятельно рекомендуем нашим клиентам прочитать памятку «Интерпретация хроматограмм секвенирования», в которой описывается, как оценивать достоверность данных, полученных с помощью секвенсоров ABI.Выберите область для размещения праймера, где вероятность ошибки последовательности низкая.
II. Ограничьте поиск регионами, которые лучше всего соответствуют вашим целям.

Вы можете быть заинтересованы в максимальном увеличении полученных данных последовательности, или вам может потребоваться исследовать последовательность только в очень конкретном месте в шаблоне. Такие потребности диктуют совершенно разные варианты размещения грунтовки.

  1. Максимально увеличить полученную последовательность, сведя к минимуму вероятность ошибок:
    Как правило, вы должны проектировать праймер настолько далеко, насколько это возможно, до 3 ‘, если вы уверены в точности последовательности, из которой взят праймер.Праймеры на противоположных прядях следует наносить по возможности в шахматном порядке.
  2. Целевое секвенирование определенной области:
    Разместите праймер так, чтобы желаемая последовательность попадала в наиболее точную область хроматограммы. Данные последовательности часто наиболее точны на расстоянии 80–150 нуклеотидов от праймера. Не рассчитывайте, что вы увидите хорошую последовательность на расстоянии менее 50 нуклеотидов от праймера или более 300 нуклеотидов (хотя мы часто получаем последовательность, начинающуюся сразу после праймера, и мы часто возвращаем 700 нуклеотидов точной последовательности).
III. Найдите праймеры-кандидаты:

Определите потенциальные праймеры для секвенирования, которые обеспечивают стабильное спаривание оснований с матричной ДНК в условиях, подходящих для циклического секвенирования. настоятельно предлагает вам использовать компьютер на этом этапе. Предлагаемые характеристики грунтовки:

  1. Длина должна быть от 18 до 30 нит, оптимальная — 20-25 нит. (Хотя у нас были некоторые успехи с праймерами длиннее 30 и короче 18).
  2. G-C желательно содержание 40-60%.
  3. Tm должна быть между 55 C и 75 C. Предупреждение: старое правило «4 градуса для каждого G-C, 2 градуса для каждого A-T» работает плохо, особенно для олигонуклеотидов короче 20 или длиннее 25 нт. Вместо этого попробуйте:
     Tm = 81,5 + 16,6 * log [Na] + 0,41 * (% GC) - 675 / длина - 0,65 * (% формамида) - (% несоответствия) 
IV. Откажитесь от праймеров-кандидатов, которые демонстрируют нежелательную самогибридизацию.
Праймеры

, способные к самогибридизации, будут недоступны для гибридизации с шаблоном.Как правило, избегайте праймеров, которые могут образовывать 4 или более последовательных связей между собой или всего 8 или более связей. Пример незначительно проблемной грунтовки:

 5'-ACGATTCATCGGACAAAGC-3 '
                                                   |||| ||||
                                        3'-CGAAACAGGCTACTTAGCA-5 '

Этот олиго образует по существу стабильный димер сам с собой с четырьмя последовательными связями в двух местах и ​​всего восемью межцепочечными связями.

Праймеры с 3′-концами, гибридизирующиеся даже временно, будут удлиняться из-за действия полимеразы, тем самым разрушая праймер и создавая ложные полосы. Будьте несколько более строгими, избегая 3′-димеров. Например, следующий праймер самодимеризуется с идеальной 3′-гибридизацией на самом себе:

 5'-CGATAGTGGGATCTAGATCCC-3 '
                                                       ||||||||||||||
                                                    3'-CCCTAGATCTAGGGTGATACG-5 '

Вышеупомянутый олиго очень плохой и почти гарантированно вызовет проблемы.Обратите внимание, что полимераза удлиняет 3′-конец во время реакции секвенирования, давая очень сильную последовательность ACTATGC. Эти полосы появятся в начале ваших «реальных» данных в виде огромных пиков, перекрывая правильную последовательность. Большинство программ разработки праймеров правильно определят такие самодимеризующиеся праймеры и предупредят вас, чтобы вы их избегали.

Обратите внимание, однако, что никакая компьютерная программа или практическая оценка не могут точно предсказать успех или неудачу учебника. Праймер, который кажется маргинальным, может работать хорошо, в то время как другой, который кажется безупречным, может вообще не работать.Избегайте очевидных проблем, создавайте лучшие праймеры, которые вы можете, но в крайнем случае, если у вас мало вариантов, просто попробуйте несколько праймеров-кандидатов, независимо от потенциальных недостатков.

V. Проверьте сайт-специфичность праймера.
Выполните поиск гомологии последовательности (например, сравнение гомологии точечной диаграммы) по всей известной матричной последовательности, чтобы проверить наличие альтернативных сайтов прайминга. Откажитесь от любых праймеров, которые проявляют «значительную» тенденцию связываться с такими сайтами. Мы можем дать лишь приблизительные рекомендации относительно того, что является «значимым».Избегайте праймеров, в которых присутствуют альтернативные сайты с (1) более чем 90% гомологией с первичным сайтом или (2) более чем 7 последовательными гомологичными нуклеотидами на 3′-конце, или (3) численностью более чем в 5 раз выше предполагаемого прайминга. сайт.
VI. Выбор среди праймеров-кандидатов.

Если на этом этапе у вас есть несколько праймеров-кандидатов, вы можете выбрать один или несколько, которые более богаты А-Т на 3′-конце. По мнению некоторых исследователей, они имеют тенденцию быть более конкретными в действии.Вы можете использовать более одного праймера, чтобы увеличить вероятность успеха.

Если у вас нет кандидатов, которые выдержали вышеуказанные критерии, вы можете быть вынуждены ослабить строгость требований к отбору. В конце концов, проверка хорошего праймера заключается только в его использовании, и эти упрощенные практические правила не могут быть точно предсказаны.

Но если повезет, у вас есть множество вариантов грунтовок. Для проекта сборки последовательностей разработайте больше праймеров, чем вы думаете, что вам действительно нужно, чтобы, если последовательность не такая длинная, как вы надеялись, вы все равно могли получить достаточно перекрывающихся данных, чтобы гарантировать хороший консенсус последовательности.Мы рекомендуем вам секвенировать обе нити для лучшего подтверждения. На одной нити разместите праймеры от 500 до 700 нт (более короткие интервалы безопаснее!). На противоположной цепи разместите праймеры в шахматном порядке от праймеров первой цепи, как показано ниже:

Нужен ли вам праймер для гелевых ногтей?

Правильная подготовка — залог успеха вашего гель-маникюра. Без этого через несколько дней ваши ногти могут поцарапаться или даже отслоиться, а это означает, что все время, потраченное на создание новых ногтей, может закончиться катастрофой!

Мы уже рассмотрели множество советов по правильной подготовке ногтей к нанесению геля, но одним из продуктов, который становится все более популярным, является праймер.При правильном использовании он может стать ключом к более стойкому гелевому маникюру для многих людей.

Что такое грунтовка?

Праймер можно использовать в самом начале маникюра с гелевым маникюром, чтобы загрунтовать ноготь. Праймеры удаляют остатки масла и жира с ногтевой пластины, которые в противном случае могут привести к тому, что базовое покрытие не прилипнет к ногтю. Это также предотвращает образование пузырьков воздуха для лучшего прилипания.

Какие виды грунтовки бывают?

Существует два типа грунтовки: бескислотная и кислотная.Бескислотная грунтовка — это наиболее часто используемая грунтовка с нежной формулой, которая значительно улучшает адгезию. Кислотный праймер лучше всего подходит для более проблемных ногтевых пластин и тех, у кого есть гормональные проблемы. Это более сильное вещество, которое протравливает ногтевую пластину и помогает гель-лаку прилипать к ногтю.

Кому нужна грунтовка?

Праймер идеально подходит для людей, которые борются со сколами или лифтингом с помощью гелевого маникюра. Он обеспечивает безупречное прилегание продукта к натуральной ногтевой пластине, выступая в качестве связующего элемента для базового покрытия, которое затем наносится поверх него.

Как наносить грунтовку?

Ваш праймер всегда наносится первым. Нанесите бескислотную грунтовку почти сухой кистью на каждый ноготь и дайте ему высохнуть примерно на 40-60 секунд. Бескислотная грунтовка не испарится полностью, и ее можно использовать, если она еще немного влажная. Если вы набиваете шпаклевку, убедитесь, что вы наносите праймер только на натуральную ногтевую пластину.

Нанося кислотную грунтовку, нанесите на ноготь 1-2 маленькие точки. Затем он сам распространился по ногтевой пластине.Используя кислотную грунтовку, убедитесь, что она полностью испарилась, прежде чем продолжить гелевый маникюр.

Каковы основные преимущества использования грунтовки? Бескислотный праймер

отлично подходит для тех из вас, кто борется с лифтингом, сколами или шелушением с помощью гелевого маникюра. Иногда на ногтях остается масло, и даже протирание салфеткой с очищающим средством не удаляет весь лишний жир с ногтевой пластины. При использовании бескислотной грунтовки масла полностью удаляются, что означает длительный маникюр без сколов!

Праймер

Acid Primer лучше всего подходит для тех, у кого очень проблемные ногтевые пластины, а также для тех, кто может страдать от каких-либо гормональных проблем или принимает определенные лекарства, которые могут повлиять на ногти.Это более сильное вещество, которое может очень помочь в подобных ситуациях.

Нужно ли использовать грунтовку?

Если вы обнаружите, что гель-маникюр длится уже 2+ недели без сколов и подтяжек, добавление дополнительного шага не всегда необходимо! Обязательно ознакомьтесь с нашим руководством по нанесению гель-лака, чтобы получить несколько полезных советов, как избежать лифтинга, прежде чем добавлять праймер в свой распорядок дня.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *